Primer

Der Titel dieses Artikels ist mehrdeutig. Weitere Bedeutungen sind unter Primer (Begriffsklärung) aufgeführt.

Als Primer (Pl.: die Primer; IPA: [ˊpʁaɪ̯mɐ]) wird in der Molekularbiologie ein Oligonukleotid bezeichnet, das als Startpunkt für DNA-replizierende Enzyme wie die DNA-Polymerase dient.

DNA-Polymerasen benötigen eine Hydroxygruppe als Startpunkt für ihre erste Verknüpfungsreaktion. Primer stellen mit ihrem 3'-OH-Ende eine passende Hydroxyfunktion zur Verfügung. Primer können sowohl aus DNA als auch aus RNA bestehen. Bei der Replikation dient in Prokaryoten und Eukaryoten RNA als Primermaterial. In Prokaryoten synthetisiert die Primase, auch als DnaG-Protein bezeichnet, die Primersequenzen. In Eukaryoten besitzt die DNA-Polymerase α eine Primasefunktion. Einen Sonderfall stellt die DNA-Synthese an den Telomeren eukaryotischer Zellen dar. Hier dient dem polymerisierendem Enzym Telomerase das 3'-OH-Ende der DNA als Primersequenz. Bei Prokaryoten werden die bei der Replikation auftauchenden Primer durch 5'-3'-Exonukleaseaktivität der Polymerase I oder durch die RNase H entfernt. In eukaryotischen Zellen werden die Primer durch verdrängende DNA-Synthese der Polymerase δ und Restriktion durch die Flap-Endonuklease entfernt.

Auch bei der In-vitro-Amplifikation von DNA, beispielsweise bei der Polymerase-Kettenreaktion (PCR), der DNA-Sequenzierung oder bei der reversen Transkription, werden Primer benötigt. Hier lässt sich mit Hilfe der Primer der spezifische DNA-Abschnitt, der amplifiziert werden soll, festlegen.

Für die PCR werden deshalb Nukleotidsequenzen, die den zu amplifizierenden DNA-Abschnitt flankieren, bestimmt. Gemäß diesen Sequenzen werden nun passende Primersequenzen synthetisch hergestellt. Ein Primer repräsentiert hierbei jeweils den gegenläufigen Strang zu seinem „Primerpartner“. Primer für PCR-Ansätze haben in der Regel eine Länge von 18-30 Nukleotiden. Diverse Biotechnologiefirmen bieten mittlerweile maßgeschneiderte Primer für molekularbiologische Anwendungen an. Durch maßgeschneiderte Missmatchprimer lassen sich über die PCR-Technik auch gezielt Mutationen in Gene einführen, die z.B. im Austausch einer Aminosäure bestehen.

Primerdesign

Primer werden mit dem Ziel designt, an spezifischer Stelle mit dem DNA-Template zu binden und so gezielte PCR-Produkte oder Hybridisierungen zu ermöglichen. Nebst den Reaktionsbedingungen (Temperatur, Puffer, Konzentrationen von Template und Primer) spielt auch der Aufbau des Primers selbst eine entscheidende Rolle. Die Schmelztemperatur (TM) eines Primers hängt von seiner Länge und seiner Zusammensetzung (GC-Gehalt) ab. Die Länge des Primers (typisch 18 bis 30 Nukleotide) wird so gewählt, dass seine Schmelztemperatur passend zur Annealing-Temperatur des PCR- oder Hybridisierungs-Prozesses ist (siehe Ablauf einer PCR-Reaktion). Der GC-Gehalt spielt eine besondere Rolle, da die Doppelhelix durch eine hohe Anzahl aufeinander folgender GC-Paarungen auf Grund von Stapelwechselwirkungen stabiler ist. Die Schmelztemperatur nimmt also mit der Anzahl an G- und C-Nukleotiden zu. Die Schmelztemperatur (in Grad Celsius) lässt sich mit mehreren Methoden berechnen:

  • die Wallace-Regel:
    $ T_{\mathrm {M} }=2\cdot (A+T)+4\cdot (G+C) $
  • die GC-Methode ist die einfachste aber auch ungenaueste Methode:
    $ T_{M}=64+41{\frac {G+C-16{,}4}{A+G+C+T}} $
  • die „salt adjusted“-Methode ist etwas genauer und bezieht die Konzentration an Na+-Ionen im Reaktionsansatz mit ein:
    $ T_{\mathrm {M} }=100,5+41\cdot {\frac {C+G}{A+C+G+T}}-{\frac {820}{A+C+G+T}}\cdot 16{,}6\cdot \log _{10}([{\mbox{Na}}^{+}]) $
  • die komplizierteste Methode ist die „base stacking“-Methode, bei der die Enthalpie- und Entropieterme der Helixbildung bei der Hybridisierung mit einbezogen werden:
    $ T_{\mathrm {M} }={\frac {\Delta H{\frac {\mbox{cal}}{\mbox{mol}}}}{\Delta S+R\ln({\frac {\text{primer}}{2}})}}-273{,}15\ ^{\circ }{\mbox{C}} $

Mittlerweile gibt es aber eine große Anzahl an Software, mit der man die Schmelztemperatur von Primern berechnen kann.

Degenerierte Primer

Degenerierte Primer werden verwendet, um mehrere homologe Gene (in verschiedenen Spezies) oder paraloge Gene (innerhalb einer Spezies) mit einem Primerpaar zu amplifizieren. Sie spielen auch eine entscheidende Rolle bei der de novo Sequenzierung von bislang unbekannten Gensequenzen, wenn also auch die Primer-Target-Sequenzen unbekannt sind.

Bei degenerierten Primern handelt es sich prinzipiell um ein Gemisch aus ähnlichen Primer-Sequenzen die in einem degeneriertem Code zusammengefasst werden. Degenerierte Primer können also auch dann noch auf eine Target-Sequenz passen, wenn diese sich im Laufe der Evolution verändert hat.

So steht beispielsweise die Sequenz

  • NTAACGTATGCGATATCGGS

für ein Gemisch der Sequenzen

  • ATAACGTATGCGATATCGGC
  • TTAACGTATGCGATATCGGC
  • GTAACGTATGCGATATCGGC
  • CTAACGTATGCGATATCGGC
  • ATAACGTATGCGATATCGGG
  • TTAACGTATGCGATATCGGG
  • GTAACGTATGCGATATCGGG
  • CTAACGTATGCGATATCGGG

Bei degenerierten Primern stellt das Primerdesign eine besondere Herausforderung dar. Primereigenschaften und mögliche Primer-Primer Interaktionen sowie mögliches Target-Mispriming müssen für jede der möglichen Sequenzen separat untersucht werden. Eine Vielzahl verschiedener Software Tools wurde speziell zum Design degenerierter Primer basierend auf Alignments oder Konsensus-Sequenzen entwickelt (z.B. easyPAC)

Weblinks

Die News der letzten Tage

26.05.2022
Zytologie | Immunologie
Ein potenzieller Jungbrunnen für das Immunsystem
Im Alter nimmt die Leistung der Immunabwehr ab, ältere Menschen sind anfälliger für Infektionen.
25.05.2022
Klimawandel | Meeresbiologie
Schwund von Kieselalgen wegen Ozeanversauerung
Kieselalgen sind die wichtigsten Produzenten von pflanzlicher Biomasse im Ozean.
25.05.2022
Klimawandel | Meeresbiologie
Neues von großen Korallenriffen und ihrer Anpassungsfähigkeit an die Klimaerwärmung
Viele Steinkorallen leben in einer Symbiose mit einzelligen Algen, die die Grundlage für die Entstehung der großen Korallenriffe darstellt.
25.05.2022
Ökologie | Klimawandel
Sibirische Tundra: Bis Mitte des Jahrtausends komplett verschwunden?
Die Erderhitzung lässt die Temperaturen in der Arktis rasant steigen.
25.05.2022
Primatologie
Wenn männliche Kumpel weniger wichtig werden als weibliche Paarungspartner
Enge Freundschaften zwischen Männchen sind im Tierreich selten, da Männchen in der Regel um Rang und Zugang zu Weibchen konkurrieren.
24.05.2022
Entwicklungsbiologie
Sind Mütter von Zwillingen fruchtbarer?
Sind Frauen, die Zwillinge haben, fruchtbarer?
23.05.2022
Bionik, Biotechnologie, Biophysik
Mikropartikel mit Gefühl
Ein internationales Forschungsteam hat winzige Partikel entwickelt, die den Sauerstoffgehalt in ihrer Umgebung anzeigen.
23.05.2022
Paläontologie | Klimawandel | Meeresbiologie
Korallen als Klimaarchive
Ungewöhnlich gut erhaltene Riffkorallen aus der Geologisch-paläontologischen Sammlung der Universität Leipzig bergen ein großes Geheimnis: Sie lassen uns weit in die Vergangenheit reisen und die klimatischen Verhältnisse in unseren Breiten rekonstruieren.
19.05.2022
Ethologie | Meeresbiologie | Säugetierkunde
Delfine behandeln Hautprobleme an Korallen
Indopazifische Grosse Tümmler reiben sich vom Schnabel bis zur Schwanzflosse an Korallen: Forscherinnen belegen nun, dass die von den Delfinen speziell ausgesuchten Korallen biofunktionelle Eigenschaften aufweisen.
19.05.2022
Taxonomie | Paläontologie | Amphibien- und Reptilienkunde
Neue Krokodilart lebte vor 39 Millionen Jahren in Asien
Wissenschaftler haben in Vietnam die Fossilien einer bisher unbekannten Krokodilart identifiziert: Das knapp vier Meter lange, fast vollständig erhaltene Skelett aus der Fundstelle Na Duong gehört zu den langschnäuzigen Krokodilen aus der Verwandtschaft der Sundagaviale.
19.05.2022
Virologie | Parasitologie | Insektenkunde
Neue Virusvariante bedroht Bienengesundheit weltweit
Eine gefährliche Variante des Krüppelflügelvirus ist weltweit auf dem Vormarsch: Das Virus befällt Honigbienen, wird von der Varroamilbe übertragen und sorgt dafür, dass ihre Flügel verkümmern und die Tiere sterben.
17.05.2022
Evolution | Land-, Forst- und Viehwirtschaft
Leben am Vulkan – in zwei Schritten zur Anpassung
Ein internationales Team hat eine Wildpopulation der Ackerschmalwand (Arabidopsis thaliana) untersucht, die sich am Fuß eines Stratovulkans angesiedelt hat.
18.05.2022
Klimawandel | Insektenkunde | Land-, Forst- und Viehwirtschaft
Insektensterben: Was stört die Kolonie-Entwicklung der Steinhummel?
Bestäubende Insekten sind für die Biodiversität und die landwirtschaftliche Produktion unersetzlich - doch seit Jahren geht der Bestand an Bienen, Hummeln und weiteren Insekten stark zurück.
18.05.2022
Biodiversität | Insektenkunde | Land-, Forst- und Viehwirtschaft
Insektenvielfalt: Öko-Landbau oder Blühstreifen besser?
Wie wirksam Agrarumweltmaßnahmen für die biologische Vielfalt sind, hängt von verschiedenen Faktoren und dem jeweiligen Blickwinkel ab.
18.05.2022
Ethologie | Primatologie
Wie flexibel Orang-Utan-Mütter mit ihrem Nachwuchs kommunizieren
Ein Forschungsteam hat Mutter-Kind-Interaktionen bei Orang-Utans untersucht und dabei besonderes Augenmerk auf individuelle Unterschiede und Flexibilität in den Kommunikationsstrategien von Orang-Utan-Müttern gelegt.
17.05.2022
Ökologie | Biodiversität | Land-, Forst- und Viehwirtschaft
Ökologie: Fließgewässer stehen weltweit schlecht da
Landwirtschaft, Habitatverlust oder Abwässer – menschgemachte Stressoren wirken sich negativ auf die biologische Vielfalt in Bächen und Flüssen aus.